Ally Ayane Crypto Game Dog - Mix of Rottweiler, Corgi, Dachshund, Golder Retriever, Pitbull terrier, Pug and Husky

Achievements

None
Ally Ayane
Wassup? Yo, call me Ally Ayane. I don't like having to stay in the car when my people go inside. I like never worrying about my dog poo. I've got people for that. My favorite game is Fetch except I never bring the ball back. Trust me. Leashes, collar and whips can be fun if you know what you're doing.
  • Purity 9%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGACACAGAAGCCACTCCAGCGAACACACAAGC
G
G
A
C
A
C
A
G
A
A
G
C
C
A
C
T
C
C
A
G
C
G
A
A
C
A
C
A
C
A
A
G
C
Genes: AH8OHNO2H4O

Composition

Rottweiler
27%
Corgi
27%
Dachshund
9%
Golder Retriever
9%
Pitbull terrier
9%
Pug
9%
Husky
9%

Current Energy

Vitality -30 points
Lunar Effect +8 points

Traits Breakdown

Body Dachshund
Tail Rottweiler
Legs Golder Retriever
Front Legs Corgi
Head Rottweiler
Ears Pitbull terrier
Snout Corgi
Mouth Pug
Nose Rottweiler
Eyes Husky
Color Corgi