Maggie Moxie Litecoin Dog - Mix of Yorkshire Terrier, Golder Retriever, Corgi, Rottweiler, Beagle, French Bulldog, St. Bernard and Pitbull terrier

Achievements

None
Maggie Moxie
I'm Maggie Moxie. How goes it? I'm having some new data architecture built for me, then I'd like to have you over to my place. I love connecting with my friends via pee-mail. I'll lick anything. If you have fleas or ticks, don't bother. My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 8%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTTAAGAAGACTACGATTATGATCCAGCAGC
C
A
C
T
T
A
A
G
A
A
G
A
C
T
A
C
G
A
T
T
A
T
G
A
T
C
C
A
G
C
A
G
C
Genes: HF88D9FBNOO

Composition

Yorkshire Terrier
18%
Golder Retriever
18%
Corgi
18%
Rottweiler
9%
Beagle
9%
French Bulldog
9%
St. Bernard
9%
Pitbull terrier
9%

Current Energy

Vitality +7 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Yorkshire Terrier
Legs Golder Retriever
Front Legs Golder Retriever
Head Beagle
Ears French Bulldog
Snout Yorkshire Terrier
Mouth St. Bernard
Nose Pitbull terrier
Eyes Corgi
Color Corgi

Parents

No Children