Willy Weaver Bitcoin Dog - Mix of Golder Retriever, Husky, Rottweiler, Boxer, Corgi and Beagle

Achievements

None
Willy Weaver
How do you do? I'm Willy Weaver. If you have fleas or ticks, don't bother. I'll outrun you for the ball if I can...that's just how I roll. My favorite position is doggie style ;) I'd like to help you shed your coat, baby. I just want to share a ball with someone, if you know what I mean...
  • Purity 15%
  • Age 56 days
  • Racing Exp 0
  • Golder Retriever 36%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACAGAAGAAGAACAAGCACACTACACAGACAC
A
A
C
A
G
A
A
G
A
A
G
A
A
C
A
A
G
C
A
C
A
C
T
A
C
A
C
A
G
A
C
A
C
Genes: G8884O4DH8H

Composition

Golder Retriever
36%
Husky
18%
Rottweiler
18%
Boxer
9%
Corgi
9%
Beagle
9%

Current Energy

Vitality +10 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears Corgi
Snout Husky
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Rottweiler

Parents

No Children