Fei Long Fyodor Dogstoevsky Cryptocurrency Dog - Mix of Boxer, French Bulldog, Pug, German Shepard, Rottweiler, Yorkshire Terrier, Golder Retriever and Labrador

Achievements

None
Fei Long Fyodor Dogstoevsky
I don't like it when my bowl is empty, so I take it to my human and it magically refills! My favorite position is doggie style ;) I like to work out by digging fresh holes in landscaped yards. My female human wears crotchless undies, but she doesn't like the ones I make for her!
  • Purity 9%
  • Age 54 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAATCAAACAACAACCGACACTTAAGACCACGA
G
A
A
T
C
A
A
A
C
A
A
C
A
A
C
C
G
A
C
A
C
T
T
A
A
G
A
C
C
A
C
G
A
Genes: 27GGG9HF859

Composition

Boxer
27%
French Bulldog
18%
Pug
9%
German Shepard
9%
Rottweiler
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Labrador
9%

Current Energy

Vitality -23 points
Lunar Effect -10 points

Traits Breakdown

Body Pug
Tail German Shepard
Legs Boxer
Front Legs Boxer
Head Boxer
Ears French Bulldog
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Golder Retriever
Eyes Labrador
Color French Bulldog

Parents

No Children