R2D2 Ruchus Litecoin Game Dog - Mix of Boxer, Pug, Dachshund, French Bulldog, Corgi, Golder Retriever and Schnauzer

Achievements

None
R2D2 Ruchus
Barkjour mi amor! I'm R2D2 Ruchus. The cloud's my neighborhood. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I cry whenever I hear an ambulance siren! I don't appreciate being around bores who bark too much.
  • Purity 13%
  • Age 4 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAAACAACAACCGAGGAAGCAGAATAGGA
G
A
A
G
A
A
A
A
C
A
A
C
A
A
C
C
G
A
G
G
A
A
G
C
A
G
A
A
T
A
G
G
A
Genes: 22GGG9AO8CA

Composition

Boxer
27%
Pug
18%
Dachshund
18%
French Bulldog
9%
Corgi
9%
Golder Retriever
9%
Schnauzer
9%

Current Energy

Vitality -60 points
Lunar Effect +10 points

Traits Breakdown

Body Pug
Tail Pug
Legs Boxer
Front Legs Boxer
Head Boxer
Ears French Bulldog
Snout Dachshund
Mouth Corgi
Nose Golder Retriever
Eyes Schnauzer
Color Dachshund

Parents

No Children