Klaus Kung Lao Litecoin Dog - Mix of Corgi, Golder Retriever, Labrador BK, Poodle, Yorkshire Terrier, Beagle, Dachshund and Maltese

Achievements

None
Klaus Kung Lao
The Ethernet where I live, rocks. I am a proud show dog. I like showing off my perfect coat! Eat, sleep, poop. Honey, I've got it made. I don't understand why I like smelling butts... As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 8%
  • Age 56 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGCAGCGACAGAAGCAGATTACTAGGAACC
G
C
A
A
G
C
A
G
C
G
A
C
A
G
A
A
G
C
A
G
A
T
T
A
C
T
A
G
G
A
A
C
C
Genes: 6OOI8O8FDAK

Composition

Corgi
27%
Golder Retriever
18%
Labrador BK
9%
Poodle
9%
Yorkshire Terrier
9%
Beagle
9%
Dachshund
9%
Maltese
9%

Current Energy

Vitality -2 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Corgi
Legs Corgi
Front Legs Poodle
Head Golder Retriever
Ears Corgi
Snout Golder Retriever
Mouth Yorkshire Terrier
Nose Beagle
Eyes Dachshund
Color Maltese

Parents

No Children