Tank Tally Cryptocurrency Dog - Mix of Boxer, Border Collie, Beagle, Pitbull terrier, Maltese and Schnauzer

Achievements

None
Tank Tally
What's up, dog? I'm Tank Tally! As a perfectionist, I have to find just the right 'spot'. I'll lick anything. Halloween costumes are the worst, I hate 'em! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 25%
  • Age 56 days
  • Racing Exp 0
  • Boxer 55%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAACAACCTAAACTCCAACAACACCAACATA
T
A
C
A
A
C
A
A
C
C
T
A
A
A
C
T
C
C
A
A
C
A
A
C
A
C
C
A
A
C
A
T
A
Genes: JGGDGNGGKGC

Composition

Boxer
55%
Border Collie
9%
Beagle
9%
Pitbull terrier
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality -7 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Boxer
Legs Boxer
Front Legs Beagle
Head Boxer
Ears Pitbull terrier
Snout Boxer
Mouth Boxer
Nose Maltese
Eyes Boxer
Color Schnauzer