Java Jingles Litecoin Dog - Mix of Shiba Inu, Beagle, Grey Wolf, French Bulldog, Pug, St. Bernard, Pitbull terrier, Corgi and Yorkshire Terrier

Achievements

None
Java Jingles
I'll outrun you for the ball if I can...that's just how I roll. I hate it when my humans fart and they blame me! Creativity is my middle name... I turn everything in to a chew toy. I'd like to leave my paw prints in the sand next to yours on a moonlit beach.
  • Purity 5%
  • Age 54 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCGTACGAGAATGAGTACTACTATCCAGCTTA
C
C
C
G
T
A
C
G
A
G
A
A
T
G
A
G
T
A
C
T
A
C
T
A
T
C
C
A
G
C
T
T
A
Genes: LE92BEDDNOF

Composition

Shiba Inu
18%
Beagle
18%
Grey Wolf
9%
French Bulldog
9%
Pug
9%
St. Bernard
9%
Pitbull terrier
9%
Corgi
9%
Yorkshire Terrier
9%

Current Energy

Vitality +8 points
Lunar Effect -4 points

Traits Breakdown

Body Grey Wolf
Tail Shiba Inu
Legs French Bulldog
Front Legs Pug
Head St. Bernard
Ears Shiba Inu
Snout Beagle
Mouth Beagle
Nose Pitbull terrier
Eyes Corgi
Color Yorkshire Terrier