Lightning Lady Rover Litecoin Dog - Mix of Beagle, Rottweiler, Golder Retriever, Poodle, Shiba Inu, Pitbull terrier, Dachshund and St. Bernard

Achievements

None
Lightning Lady Rover
It's a barkin' beautiful day! Lightning Lady Rover here. I keep my well-built figure with zeros and ones. I love car rides when I can stick my head out the window. I don't like having to stay off the furniture. I'm into recreational spankings and a little 'ruff' play.
  • Purity 8%
  • Age 56 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGTATCCCTACTACACGGAAGAAGACACTGA
G
A
C
G
T
A
T
C
C
C
T
A
C
T
A
C
A
C
G
G
A
A
G
A
A
G
A
C
A
C
T
G
A
Genes: IENDDHA88HB

Composition

Beagle
18%
Rottweiler
18%
Golder Retriever
18%
Poodle
9%
Shiba Inu
9%
Pitbull terrier
9%
Dachshund
9%
St. Bernard
9%

Current Energy

Vitality -8 points
Lunar Effect +2 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Pitbull terrier
Front Legs Beagle
Head Beagle
Ears Rottweiler
Snout Dachshund
Mouth Golder Retriever
Nose Golder Retriever
Eyes Rottweiler
Color St. Bernard

Parents

No Children