Maui Maisy Litecoin Game Dog - Mix of Border Collie, Yorkshire Terrier, French Bulldog, Husky, Grey Wolf, Rottweiler and Pitbull terrier

Achievements

None
Maui Maisy
Hello, I'm Maui Maisy. How's it goin'? The internet's my home. Once I caught a seagull, but it scared me so I let it go. I'm sick of having my nails clipped, those are to help me dig! My favorite game is Fetch except I never bring the ball back. I am a proud show dog. I like showing off my perfect coat!
  • Purity 11%
  • Age 4 months
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATTACGATACTACACACCCCACTCCCGATAC
T
T
A
T
T
A
C
G
A
T
A
C
T
A
C
A
C
A
C
C
C
C
A
C
T
C
C
C
G
A
T
A
C
Genes: FF9JJ4LHN9J

Composition

Border Collie
27%
Yorkshire Terrier
18%
French Bulldog
18%
Husky
9%
Grey Wolf
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality -23 points
Lunar Effect -6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Yorkshire Terrier
Legs French Bulldog
Front Legs Border Collie
Head Border Collie
Ears Husky
Snout Grey Wolf
Mouth Rottweiler
Nose Pitbull terrier
Eyes French Bulldog
Color Border Collie