Wally Winnie Cryptocurrency Game Dog - Mix of Yorkshire Terrier, Golder Retriever, Beagle, Husky, French Bulldog, Rottweiler, Shiba Inu and Pug

Achievements

None
Wally Winnie
Hey there... I'm Wally Winnie. I'm having some new data architecture built for me, then I'd like to have you over to my place. I love unconditionally. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I just want to "share a bone"... ;)
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACGACACTTAAGACTAAGATTAGTAGAACTA
A
C
A
C
G
A
C
A
C
T
T
A
A
G
A
C
T
A
A
G
A
T
T
A
G
T
A
G
A
A
C
T
A
Genes: 49HF8D8FE2D

Composition

Yorkshire Terrier
18%
Golder Retriever
18%
Beagle
18%
Husky
9%
French Bulldog
9%
Rottweiler
9%
Shiba Inu
9%
Pug
9%

Current Energy

Vitality -32 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Rottweiler
Front Legs Yorkshire Terrier
Head Golder Retriever
Ears Beagle
Snout Golder Retriever
Mouth Yorkshire Terrier
Nose Shiba Inu
Eyes Pug
Color Beagle