Brook Beetle Crypto Dog - Mix of Dachshund, Pug, Maltese, Golder Retriever, Husky, Boxer and Rottweiler

Achievements

None
Brook Beetle
How do you do? I'm Brook Beetle. I slept with a cat and I liked it. Long or short hair works for me, just no baldies please. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. My favorite game is Fetch except I never bring the ball back.
  • Purity 9%
  • Age 56 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCAGAGGAGAAGGAACAGAAAACGGAGAACAC
A
C
C
A
G
A
G
G
A
G
A
A
G
G
A
A
C
A
G
A
A
A
A
C
G
G
A
G
A
A
C
A
C
Genes: K8A2A42GA2H

Composition

Dachshund
27%
Pug
27%
Maltese
9%
Golder Retriever
9%
Husky
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality -28 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Golder Retriever
Legs Dachshund
Front Legs Pug
Head Dachshund
Ears Husky
Snout Pug
Mouth Boxer
Nose Dachshund
Eyes Pug
Color Rottweiler