Kid Kosmo Litecoin Dog - Mix of Golder Retriever, Pug, Rottweiler, Boxer, Labrador, French Bulldog and Pitbull terrier

Achievements

None
Kid Kosmo
My turn-offs are rolled up newspapers and loud noises. I am on a mission to sniff all the butts in the world. ALL the butts. I adore sleeping upside down with my tongue hanging out! Rolling around on the carpet after a bath is my favorite way to dry.
  • Purity 11%
  • Age 54 days
  • Racing Exp 0
  • Golder Retriever 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAAGAAGAGAAAACCACGAACCACGACACTCC
A
G
A
A
G
A
A
G
A
G
A
A
A
A
C
C
A
C
G
A
A
C
C
A
C
G
A
C
A
C
T
C
C
Genes: 8882GH259HN

Composition

Golder Retriever
27%
Pug
18%
Rottweiler
18%
Boxer
9%
Labrador
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Pug
Head Boxer
Ears Rottweiler
Snout Pug
Mouth Labrador
Nose French Bulldog
Eyes Rottweiler
Color Pitbull terrier