T-Bone Timber Litecoin Dog - Mix of Maltese, St. Bernard, Golder Retriever, Labrador BK, Rottweiler, Husky, Boxer and Border Collie

Achievements

None
T-Bone Timber
Greetings. My name is T-Bone Timber. I run with a pack in the data warehouse. You know the worst? Watching my humans 'get it on' when I've got no one. Removing excess stuffing from pillows is my favorite hobby. My bark alone scares birds out of my yard.
  • Purity 8%
  • Age 56 days
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAAGAGCACACACCACCTGAACAAACACCTAC
T
G
A
A
G
A
G
C
A
C
A
C
A
C
C
A
C
C
T
G
A
A
C
A
A
A
C
A
C
C
T
A
C
Genes: B86HKKB4GKJ

Composition

Maltese
27%
St. Bernard
18%
Golder Retriever
9%
Labrador BK
9%
Rottweiler
9%
Husky
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail Golder Retriever
Legs Labrador BK
Front Legs Rottweiler
Head Maltese
Ears Maltese
Snout St. Bernard
Mouth Husky
Nose Boxer
Eyes Maltese
Color Border Collie