Montgomery Moonshine Crypto Game Dog - Mix of Labrador, Border Collie, Boxer, Rottweiler, St. Bernard, Beagle, Golder Retriever and Yorkshire Terrier

Achievements

None
Montgomery Moonshine
Once you go digital, baby, you never go back. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I never met a crotch or a butt I didn't like, but I'm just friendly that way. My human is my best friend, looking for someone who is okay with that.
  • Purity 6%
  • Age 56 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCCATACTGACCACTAAACAACAGATACTTA
C
A
C
C
C
A
T
A
C
T
G
A
C
C
A
C
T
A
A
A
C
A
A
C
A
G
A
T
A
C
T
T
A
Genes: H5JB5DGG8JF

Composition

Labrador
18%
Border Collie
18%
Boxer
18%
Rottweiler
9%
St. Bernard
9%
Beagle
9%
Golder Retriever
9%
Yorkshire Terrier
9%

Current Energy

Vitality +11 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Labrador
Legs Border Collie
Front Legs St. Bernard
Head Labrador
Ears Beagle
Snout Boxer
Mouth Boxer
Nose Golder Retriever
Eyes Border Collie
Color Yorkshire Terrier

Parents

No Children