Abbey Ashley Crypto Game Dog - Mix of Beagle, Border Collie, Corgi, Maltese, Rottweiler, Dachshund, Golder Retriever, Grey Wolf, Shiba Inu and St. Bernard

Achievements

None
Abbey Ashley
Yo dog! Abbey Ashley here. Virtually, I'll come whenever you call. I don't understand why I like smelling butts... I love waking up early then indulging in long afternoon naps. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 1%
  • Age 56 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGCACCCACGGACTAAGACTACCCGTATGA
T
A
C
A
G
C
A
C
C
C
A
C
G
G
A
C
T
A
A
G
A
C
T
A
C
C
C
G
T
A
T
G
A
Genes: JOKHAD8DLEB

Composition

Beagle
18%
Border Collie
9%
Corgi
9%
Maltese
9%
Rottweiler
9%
Dachshund
9%
Golder Retriever
9%
Grey Wolf
9%
Shiba Inu
9%
St. Bernard
9%

Current Energy

Vitality -2 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Maltese
Front Legs Rottweiler
Head Dachshund
Ears Beagle
Snout Golder Retriever
Mouth Beagle
Nose Grey Wolf
Eyes Shiba Inu
Color St. Bernard

Parents

No Children