Littlefinger Lacie Bitcoin Game Dog - Mix of French Bulldog, Beagle, Husky, Border Collie, Golder Retriever, German Shepard, Labrador, Poodle, Dachshund and Shiba Inu

Achievements

None
Littlefinger Lacie
Creativity is my middle name... I turn everything in to a chew toy. It turns me on when I can show an older dog a new trick. Air Bud is definitely my favorite movie. What a role model! I'm not a fan of sleeping on the floor. This body was made for cuddles!
  • Purity 1%
  • Age 56 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAACATACAGATCACGACCACGAGACGGAGTA
C
T
A
A
C
A
T
A
C
A
G
A
T
C
A
C
G
A
C
C
A
C
G
A
G
A
C
G
G
A
G
T
A
Genes: D4J87959IAE

Composition

French Bulldog
18%
Beagle
9%
Husky
9%
Border Collie
9%
Golder Retriever
9%
German Shepard
9%
Labrador
9%
Poodle
9%
Dachshund
9%
Shiba Inu
9%

Current Energy

Vitality +8 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Husky
Legs Border Collie
Front Legs Golder Retriever
Head German Shepard
Ears French Bulldog
Snout Labrador
Mouth French Bulldog
Nose Poodle
Eyes Dachshund
Color Shiba Inu

Parents

No Children