Buffy Berkeley Crypto Dog - Mix of Rottweiler, Shiba Inu, Pug, Yorkshire Terrier, Boxer, Border Collie, Maltese and Golder Retriever

Achievements

None
Buffy Berkeley
You can call me Buffy Berkeley, everybody else does. My AI may be artificial, but at least I'm intelligent. I enjoy chasing my tail around. I really dislike stinky flea collars. I've always had a crush on Lassie. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGTATTAAACTACGAACACACCGTAAGAGAA
C
A
C
G
T
A
T
T
A
A
A
C
T
A
C
G
A
A
C
A
C
A
C
C
G
T
A
A
G
A
G
A
A
Genes: HEFGJ2HKE82

Composition

Rottweiler
18%
Shiba Inu
18%
Pug
18%
Yorkshire Terrier
9%
Boxer
9%
Border Collie
9%
Maltese
9%
Golder Retriever
9%

Current Energy

Vitality -30 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Shiba Inu
Legs Yorkshire Terrier
Front Legs Boxer
Head Border Collie
Ears Pug
Snout Rottweiler
Mouth Maltese
Nose Shiba Inu
Eyes Golder Retriever
Color Pug

Parents

No Children