Petunia Prost Bitcoin Dog - Mix of Corgi, Yorkshire Terrier, Grey Wolf, Boxer, Maltese, Husky, French Bulldog, Poodle and St. Bernard

Achievements

None
Petunia Prost
As a digital dog, let me say Bob Dole did not invent the internet. Dragging my butt on the carpet feels so good. I hate having to share my food dish... Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I like never worrying about my dog poo. I've got people for that.
  • Purity 3%
  • Age 4 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCTTAAGCCCCAACACCACACGATTAGACTGA
A
G
C
T
T
A
A
G
C
C
C
C
A
A
C
A
C
C
A
C
A
C
G
A
T
T
A
G
A
C
T
G
A
Genes: OFOLGK49FIB

Composition

Corgi
18%
Yorkshire Terrier
18%
Grey Wolf
9%
Boxer
9%
Maltese
9%
Husky
9%
French Bulldog
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -29 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Yorkshire Terrier
Legs Corgi
Front Legs Grey Wolf
Head Boxer
Ears Maltese
Snout Husky
Mouth French Bulldog
Nose Yorkshire Terrier
Eyes Poodle
Color St. Bernard