Elvis Emmy Cryptocurrency Game Dog - Mix of Border Collie, Dachshund, St. Bernard, Pug and Corgi

Achievements

None
Elvis Emmy
Hello, there. Elvis Emmy here. Someday I'm gonna breakout from inside this server. I hate it when my humans fart and they blame me! When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Once I caught a seagull, but it scared me so I let it go. I'm not that picky. Wanna mate?
  • Purity 38%
  • Age 56 days
  • Racing Exp 0
  • Border Collie 64%
  • 0 races
  • Gen 7
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACGGATACTGATACTACTACTACGAAAGC
T
A
C
T
A
C
G
G
A
T
A
C
T
G
A
T
A
C
T
A
C
T
A
C
T
A
C
G
A
A
A
G
C
Genes: JJAJBJJJJ2O

Composition

Border Collie
64%
Dachshund
9%
St. Bernard
9%
Pug
9%
Corgi
9%

Current Energy

Vitality +10 points
Lunar Effect +16 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head St. Bernard
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Pug
Color Corgi

Parents

No Children