Dash Dandy Bitcoin Dog - Mix of Border Collie, Labrador BK, Pitbull terrier, Golder Retriever, Husky, Pug, Boxer and French Bulldog

Achievements

None
Dash Dandy
I am a guard dog for the data warehouse. Creativity is my middle name... I turn everything in to a chew toy. They say my bite is worse than my bark. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect!
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAGAGCAACATACTACGAAAACCGATACGCA
T
C
C
A
G
A
G
C
A
A
C
A
T
A
C
T
A
C
G
A
A
A
A
C
C
G
A
T
A
C
G
C
A
Genes: N864JJ2G9J6

Composition

Border Collie
27%
Labrador BK
18%
Pitbull terrier
9%
Golder Retriever
9%
Husky
9%
Pug
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Labrador BK
Front Legs Husky
Head Border Collie
Ears Border Collie
Snout Pug
Mouth Boxer
Nose French Bulldog
Eyes Border Collie
Color Labrador BK

Parents

No Children