Nestle Nitro Litecoin Dog - Mix of Boxer, Pitbull terrier, St. Bernard, Dachshund, Corgi, Beagle, Maltese and Yorkshire Terrier

Achievements

None
Nestle Nitro
I like to respond to sad puppy eyes with sad puppy eyes of my own. They say my bite is worse than my bark. I hate being left alone all day. Little Bow Wow is my favorite musician. I just assume he's a dog... As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 6%
  • Age 4 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAGGAAGCTCCCTAAACACCTCCAACTTAAAC
T
G
A
G
G
A
A
G
C
T
C
C
C
T
A
A
A
C
A
C
C
T
C
C
A
A
C
T
T
A
A
A
C
Genes: BAONDGKNGFG

Composition

Boxer
27%
Pitbull terrier
18%
St. Bernard
9%
Dachshund
9%
Corgi
9%
Beagle
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -54 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail Dachshund
Legs Corgi
Front Legs Pitbull terrier
Head Beagle
Ears Boxer
Snout Maltese
Mouth Pitbull terrier
Nose Boxer
Eyes Yorkshire Terrier
Color Boxer