Mister Miyagi Miss Priss Digital Cryptocurrency Dog - Mix of Poodle, St. Bernard, German Shepard, Maltese, Border Collie, Husky, Shiba Inu, Pug, French Bulldog and Yorkshire Terrier

Achievements

None
Mister Miyagi Miss Priss
Hi! My name is Mister Miyagi Miss Priss. I live in your digital dreams. I like to work out by digging fresh holes in landscaped yards. My favorite position is doggie style ;) Blue toilet water turns me off. I'll lick anything.
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAGACTCAACCTACACAGTAGAACGAGACTTA
T
G
A
G
A
C
T
C
A
A
C
C
T
A
C
A
C
A
G
T
A
G
A
A
C
G
A
G
A
C
T
T
A
Genes: BI7KJ4E29IF

Composition

Poodle
18%
St. Bernard
9%
German Shepard
9%
Maltese
9%
Border Collie
9%
Husky
9%
Shiba Inu
9%
Pug
9%
French Bulldog
9%
Yorkshire Terrier
9%

Current Energy

Vitality -34 points
Lunar Effect +2 points

Traits Breakdown

Body St. Bernard
Tail Poodle
Legs German Shepard
Front Legs Maltese
Head Border Collie
Ears Husky
Snout Shiba Inu
Mouth Pug
Nose French Bulldog
Eyes Poodle
Color Yorkshire Terrier