Barkley Buttons Bitcoin Dog - Mix of Corgi, Husky, Maltese, Golder Retriever, Yorkshire Terrier, Pug and Labrador

Achievements

None
Barkley Buttons
Let me introduce myself, I'm Barkley Buttons. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Chasing anything that will run is so much fun, I could do that all day.
  • Purity 14%
  • Age 56 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCAGAAGCACAACAACAAGCAGCTTAGAACCA
A
C
C
A
G
A
A
G
C
A
C
A
A
C
A
A
C
A
A
G
C
A
G
C
T
T
A
G
A
A
C
C
A
Genes: K8O444OOF25

Composition

Corgi
27%
Husky
27%
Maltese
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Pug
9%
Labrador
9%

Current Energy

Vitality +2 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Golder Retriever
Legs Corgi
Front Legs Husky
Head Husky
Ears Husky
Snout Corgi
Mouth Corgi
Nose Yorkshire Terrier
Eyes Pug
Color Labrador