Interstate Izzy Digital Cryptocurrency Dog - Mix of Pitbull terrier, Maltese, Pug, Schnauzer, Labrador BK, Dachshund, Border Collie, Shiba Inu and St. Bernard

Achievements

None
Interstate Izzy
Howdy! I'm Interstate Izzy. Squeaky toys are the best, don't you agree? Forget plastic hotdogs...I'm into the classic chew toys like slippers. I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 5%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGAAATAGCAGGAACCTACGTATGAACCTCC
T
C
C
G
A
A
A
T
A
G
C
A
G
G
A
A
C
C
T
A
C
G
T
A
T
G
A
A
C
C
T
C
C
Genes: N2C6AKJEBKN

Composition

Pitbull terrier
18%
Maltese
18%
Pug
9%
Schnauzer
9%
Labrador BK
9%
Dachshund
9%
Border Collie
9%
Shiba Inu
9%
St. Bernard
9%

Current Energy

Vitality -37 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Pug
Legs Schnauzer
Front Legs Labrador BK
Head Dachshund
Ears Maltese
Snout Border Collie
Mouth Shiba Inu
Nose St. Bernard
Eyes Maltese
Color Pitbull terrier