Josie Jynx Cryptocurrency Dog - Mix of Border Collie, Maltese, Labrador BK, Corgi, Schnauzer, Yorkshire Terrier and French Bulldog

Achievements

None
Josie Jynx
Yo dog! Josie Jynx here. Eat, sleep, poop. Honey, I've got it made. I don't like running outta pee when there are still so many trees. I love a good book... I find them quite tasty. People food disagrees with me. Whew! You can tell.
  • Purity 12%
  • Age 54 days
  • Racing Exp 0
  • Border Collie 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGCAAGCTACACCTACATATTAACCCGATAC
T
A
C
G
C
A
A
G
C
T
A
C
A
C
C
T
A
C
A
T
A
T
T
A
A
C
C
C
G
A
T
A
C
Genes: J6OJKJCFK9J

Composition

Border Collie
36%
Maltese
18%
Labrador BK
9%
Corgi
9%
Schnauzer
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality +4 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Corgi
Front Legs Border Collie
Head Maltese
Ears Border Collie
Snout Schnauzer
Mouth Yorkshire Terrier
Nose Maltese
Eyes French Bulldog
Color Border Collie

Parents

No Children