Linux Lark Cryptocurrency Dog - Mix of Golder Retriever, Husky, Beagle, St. Bernard and Rottweiler

Achievements

None
Linux Lark
Even living on the internet like I do, too much kibble makes my bandwidth expand. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I don't mind sharing my bed with someone I just met, if we can cuddle. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.
  • Purity 29%
  • Age 56 days
  • Racing Exp 0
  • Golder Retriever 55%
  • 0 races
  • Gen 4
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGAAGACTAAGAAGATGACACACAAGAAGA
A
C
A
A
G
A
A
G
A
C
T
A
A
G
A
A
G
A
T
G
A
C
A
C
A
C
A
A
G
A
A
G
A
Genes: 488D88BH488

Composition

Golder Retriever
55%
Husky
18%
Beagle
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality -1 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Golder Retriever
Front Legs Beagle
Head Golder Retriever
Ears Golder Retriever
Snout St. Bernard
Mouth Rottweiler
Nose Husky
Eyes Golder Retriever
Color Golder Retriever