Wayne Watson Crypto Dog - Mix of Beagle, Shiba Inu, Maltese, Boxer, Labrador and Rottweiler

Achievements

None
Wayne Watson
Virtually, I'll come whenever you call. I'm totally against baths! They are the worst! As a perfectionist, I have to find just the right 'spot'. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 9%
  • Age 56 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACCAGTAACCCTAAACCACCTAACCAACCTA
G
T
A
C
C
A
G
T
A
A
C
C
C
T
A
A
A
C
C
A
C
C
T
A
A
C
C
A
A
C
C
T
A
Genes: E5EKDGHDKGD

Composition

Beagle
27%
Shiba Inu
18%
Maltese
18%
Boxer
18%
Labrador
9%
Rottweiler
9%

Current Energy

Vitality -18 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Labrador
Legs Shiba Inu
Front Legs Maltese
Head Beagle
Ears Boxer
Snout Rottweiler
Mouth Beagle
Nose Maltese
Eyes Boxer
Color Beagle

Parents

No Children