Gabriella Gabriella Bitcoin Dog - Mix of Shiba Inu, Pitbull terrier, Golder Retriever, Maltese, Dachshund, Rottweiler, Pug and Husky

Achievements

None
Gabriella Gabriella
Good day to you! I'm Gabriella Gabriella! My favorite way to relax is to be scratched on my belly. I don't like running outta pee when there are still so many trees. People food disagrees with me. Whew! You can tell. When I can break free, I enjoy exploring my neighborhood without my human.
  • Purity 4%
  • Age 54 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAACCGTATCCAGATCCGGACACGAAACAAGA
G
T
A
A
C
C
G
T
A
T
C
C
A
G
A
T
C
C
G
G
A
C
A
C
G
A
A
A
C
A
A
G
A
Genes: EKEN8NAH248

Composition

Shiba Inu
18%
Pitbull terrier
18%
Golder Retriever
18%
Maltese
9%
Dachshund
9%
Rottweiler
9%
Pug
9%
Husky
9%

Current Energy

Vitality -8 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Maltese
Legs Shiba Inu
Front Legs Pitbull terrier
Head Golder Retriever
Ears Pitbull terrier
Snout Dachshund
Mouth Rottweiler
Nose Pug
Eyes Husky
Color Golder Retriever