Eddie Elena Crypto Game Dog - Mix of Boxer, Pitbull terrier, Shiba Inu, Dachshund, St. Bernard, Pug, German Shepard and Rottweiler

Achievements

None
Eddie Elena
Small yappy creatures bug me...they disturb my zen. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 4%
  • Age 54 days
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCCAACTCCGGATGAGTAGAAGTATCACAC
A
A
C
T
C
C
A
A
C
T
C
C
G
G
A
T
G
A
G
T
A
G
A
A
G
T
A
T
C
A
C
A
C
Genes: GNGNABE2E7H

Composition

Boxer
18%
Pitbull terrier
18%
Shiba Inu
18%
Dachshund
9%
St. Bernard
9%
Pug
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality -7 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Pitbull terrier
Legs Boxer
Front Legs Pitbull terrier
Head Dachshund
Ears St. Bernard
Snout Shiba Inu
Mouth Pug
Nose Shiba Inu
Eyes German Shepard
Color Rottweiler