Suki Shorty Litecoin Dog - Mix of Boxer, French Bulldog, Shiba Inu, Dachshund, Corgi, Husky and Rottweiler

Achievements

None
Suki Shorty
Nyan Cat is my best friend here in the cyberspace. The smell of fresh manure to roll in makes me wild. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 8%
  • Age 57 days
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCGAGTAAACGGAGGACGAAGCACAGTACAC
A
A
C
C
G
A
G
T
A
A
A
C
G
G
A
G
G
A
C
G
A
A
G
C
A
C
A
G
T
A
C
A
C
Genes: G9EGAA9O4EH

Composition

Boxer
18%
French Bulldog
18%
Shiba Inu
18%
Dachshund
18%
Corgi
9%
Husky
9%
Rottweiler
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail French Bulldog
Legs Shiba Inu
Front Legs Boxer
Head Dachshund
Ears Dachshund
Snout French Bulldog
Mouth Corgi
Nose Husky
Eyes Shiba Inu
Color Rottweiler