Ivan Isadora Bitcoin Dog - Mix of Pug, Yorkshire Terrier, Rottweiler, Dachshund, Maltese, Husky, Boxer, German Shepard, French Bulldog and Schnauzer

Achievements

None
Ivan Isadora
Hey there! Baby, call me Ivan Isadora. It doesn't matter to me which team I play for... I just like tail. I'm willing to try little bondage, so my human chained me up! Halloween costumes are the worst, I hate 'em! I just want a snuggle buddy with a nice, soft coat.
  • Purity 1%
  • Age 57 days
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACACGGAACCACAAACGAATCACGAATAGAA
T
T
A
C
A
C
G
G
A
A
C
C
A
C
A
A
A
C
G
A
A
T
C
A
C
G
A
A
T
A
G
A
A
Genes: FHAK4G279C2

Composition

Pug
18%
Yorkshire Terrier
9%
Rottweiler
9%
Dachshund
9%
Maltese
9%
Husky
9%
Boxer
9%
German Shepard
9%
French Bulldog
9%
Schnauzer
9%

Current Energy

Vitality -8 points
Lunar Effect -8 points

Traits Breakdown

Body Yorkshire Terrier
Tail Rottweiler
Legs Dachshund
Front Legs Maltese
Head Husky
Ears Boxer
Snout Pug
Mouth German Shepard
Nose French Bulldog
Eyes Schnauzer
Color Pug