Cheddar Chelsea Digital Cryptocurrency Dog - Mix of Maltese, Corgi, Rottweiler, Husky, Pitbull terrier, Yorkshire Terrier and French Bulldog

Achievements

None
Cheddar Chelsea
Hi! My name is Cheddar Chelsea. I've been looking for love in all the wrong places... I'll be honest...Napping is my favorite so we gotta go slow. Watching kids play without me is the worst, no? I enjoy going to the dog park to see all my friends!
  • Purity 14%
  • Age 4 months
  • Racing Exp 0
  • Maltese 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCACACATCCACCACCACCAGCTTACGAAGC
A
C
C
C
A
C
A
C
A
T
C
C
A
C
C
A
C
C
A
C
C
A
G
C
T
T
A
C
G
A
A
G
C
Genes: KH4NKKKOF9O

Composition

Maltese
36%
Corgi
18%
Rottweiler
9%
Husky
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality -44 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Husky
Front Legs Pitbull terrier
Head Maltese
Ears Maltese
Snout Maltese
Mouth Corgi
Nose Yorkshire Terrier
Eyes French Bulldog
Color Corgi