Pretty-Girl Punky Litecoin Game Dog - Mix of St. Bernard, Maltese, Corgi, Shiba Inu, Pitbull terrier, Rottweiler and German Shepard

Achievements

None
Pretty-Girl Punky
I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. Don't bother contacting me if you like cats. As a perfectionist, I have to find just the right 'spot'. My human is my best friend, looking for someone who is okay with that.
  • Purity 7%
  • Age 4 months
  • Racing Exp 0
  • St. Bernard 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAGTATCCTGACACACCAGCTCAAGCTGAACC
T
G
A
G
T
A
T
C
C
T
G
A
C
A
C
A
C
C
A
G
C
T
C
A
A
G
C
T
G
A
A
C
C
Genes: BENBHKO7OBK

Composition

St. Bernard
27%
Maltese
18%
Corgi
18%
Shiba Inu
9%
Pitbull terrier
9%
Rottweiler
9%
German Shepard
9%

Current Energy

Vitality -42 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail Shiba Inu
Legs Pitbull terrier
Front Legs St. Bernard
Head Rottweiler
Ears Maltese
Snout Corgi
Mouth German Shepard
Nose Corgi
Eyes St. Bernard
Color Maltese