Donald Trump Dutches Bitcoin Dog - Mix of Pitbull terrier, Boxer, Labrador BK, Shiba Inu, Grey Wolf and French Bulldog

Achievements

None
Donald Trump Dutches
I'm not a bad dog, my data is just configured that way. If you enjoy growling through fences as much as I do, we should get together. After introductory sniffing, I like some licking. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I'm just looking for some puppy love.
  • Purity 15%
  • Age 57 days
  • Racing Exp 0
  • Pitbull terrier 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAACGCAGTATCCTCCCCCAACTCCAACCGA
T
C
C
A
A
C
G
C
A
G
T
A
T
C
C
T
C
C
C
C
C
A
A
C
T
C
C
A
A
C
C
G
A
Genes: NG6ENNLGNG9

Composition

Pitbull terrier
36%
Boxer
27%
Labrador BK
9%
Shiba Inu
9%
Grey Wolf
9%
French Bulldog
9%

Current Energy

Vitality +4 points
Lunar Effect -8 points

Traits Breakdown

Body Pitbull terrier
Tail Boxer
Legs Labrador BK
Front Legs Shiba Inu
Head Pitbull terrier
Ears Pitbull terrier
Snout Grey Wolf
Mouth Boxer
Nose Pitbull terrier
Eyes Boxer
Color French Bulldog

Parents

No Children