Casper Cash Crypto Game Dog - Mix of Pitbull terrier, Shiba Inu, Corgi, Rottweiler, Labrador BK, Golder Retriever, Yorkshire Terrier and Grey Wolf

Achievements

None
Casper Cash
Well hello, beautiful. My name's Casper Cash. I like big butts, I cannot lie. I hate it when I am not the center of attention. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I never met a leg I didn't want to hump.
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCAGCCACTCCGCAGTAAGAGTATTACCC
T
C
C
T
C
C
A
G
C
C
A
C
T
C
C
G
C
A
G
T
A
A
G
A
G
T
A
T
T
A
C
C
C
Genes: NNOHN6E8EFL

Composition

Pitbull terrier
27%
Shiba Inu
18%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Grey Wolf
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Corgi
Front Legs Rottweiler
Head Pitbull terrier
Ears Labrador BK
Snout Shiba Inu
Mouth Golder Retriever
Nose Shiba Inu
Eyes Yorkshire Terrier
Color Grey Wolf

Parents

No Children