Bug Betsy Bitcoin Game Dog - Mix of Border Collie, French Bulldog, Beagle, Grey Wolf, Yorkshire Terrier, Pug, Dachshund, Shiba Inu and Boxer

Achievements

None
Bug Betsy
You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACCGATACCTACCCTTAGAAGGAGTAAACTAC
T
A
C
C
G
A
T
A
C
C
T
A
C
C
C
T
T
A
G
A
A
G
G
A
G
T
A
A
A
C
T
A
C
Genes: J9JDLF2AEGJ

Composition

Border Collie
27%
French Bulldog
9%
Beagle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Pug
9%
Dachshund
9%
Shiba Inu
9%
Boxer
9%

Current Energy

Vitality +9 points
Lunar Effect -12 points

Traits Breakdown

Body Border Collie
Tail French Bulldog
Legs Border Collie
Front Legs Beagle
Head Grey Wolf
Ears Yorkshire Terrier
Snout Pug
Mouth Dachshund
Nose Shiba Inu
Eyes Boxer
Color Border Collie