Fluff Frisco Crypto Dog - Mix of Shiba Inu, French Bulldog, Labrador BK, Golder Retriever, Pitbull terrier, Pug and Boxer

Achievements

None
Fluff Frisco
Sup? ;-) I'm Fluff Frisco. In my digital world, cats aren't the only ones who hack. I'd like to help you shed your coat, baby. I hate it when my human runs out of poop-bags. How embarrassing! I'm looking for someone who is also playful, feisty and happy.
  • Purity 12%
  • Age 57 days
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGCAAGACGACGAGTACGATCCGAAAAC
G
T
A
G
T
A
G
C
A
A
G
A
C
G
A
C
G
A
G
T
A
C
G
A
T
C
C
G
A
A
A
A
C
Genes: EE6899E9N2G

Composition

Shiba Inu
27%
French Bulldog
27%
Labrador BK
9%
Golder Retriever
9%
Pitbull terrier
9%
Pug
9%
Boxer
9%

Current Energy

Vitality +6 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Labrador BK
Front Legs Golder Retriever
Head French Bulldog
Ears French Bulldog
Snout Shiba Inu
Mouth French Bulldog
Nose Pitbull terrier
Eyes Pug
Color Boxer