Nfl Nike Bitcoin Dog - Mix of Golder Retriever, Labrador, Schnauzer, Yorkshire Terrier and French Bulldog

Achievements

None
Nfl Nike
Pleased to meet you! My name's Nfl Nike. Creativity is my middle name... I turn everything in to a chew toy. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 29%
  • Age 57 days
  • Racing Exp 0
  • Golder Retriever 55%
  • 0 races
  • Gen 10
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAAGAATAAGAAGAAGACCATTACCAAGACGA
A
G
A
A
G
A
A
T
A
A
G
A
A
G
A
A
G
A
C
C
A
T
T
A
C
C
A
A
G
A
C
G
A
Genes: 88C8885F589

Composition

Golder Retriever
55%
Labrador
18%
Schnauzer
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality -3 points
Lunar Effect -10 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Schnauzer
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Labrador
Mouth Yorkshire Terrier
Nose Labrador
Eyes Golder Retriever
Color French Bulldog