Kenzi Kipper Cryptocurrency Game Dog - Mix of Rottweiler, St. Bernard, Shiba Inu, Maltese, French Bulldog, Beagle and Husky

Achievements

None
Kenzi Kipper
Chasing anything that will run is so much fun, I could do that all day. I hate never catching that damn rabbit in my dreams. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'm looking for a hard-working service animal who can keep up with me.
  • Purity 7%
  • Age 58 days
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGACACTGAACCCACCGAGTACTAACAGTA
C
A
C
T
G
A
C
A
C
T
G
A
A
C
C
C
A
C
C
G
A
G
T
A
C
T
A
A
C
A
G
T
A
Genes: HBHBKH9ED4E

Composition

Rottweiler
27%
St. Bernard
18%
Shiba Inu
18%
Maltese
9%
French Bulldog
9%
Beagle
9%
Husky
9%

Current Energy

Vitality +2 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Rottweiler
Front Legs St. Bernard
Head Maltese
Ears Rottweiler
Snout French Bulldog
Mouth Shiba Inu
Nose Beagle
Eyes Husky
Color Shiba Inu