Blake Breeze Crypto Dog - Mix of Husky, Dachshund, French Bulldog, Rottweiler, Grey Wolf, Beagle and Border Collie

Achievements

None
Blake Breeze
Hey! Call me Blake Breeze. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! I just want a snuggle buddy with a nice, soft coat.
  • Purity 10%
  • Age 58 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACACACACCCACAGGAACACTAGGATACACA
C
G
A
C
A
C
A
C
A
C
C
C
A
C
A
G
G
A
A
C
A
C
T
A
G
G
A
T
A
C
A
C
A
Genes: 9H4L4A4DAJ4

Composition

Husky
36%
Dachshund
18%
French Bulldog
9%
Rottweiler
9%
Grey Wolf
9%
Beagle
9%
Border Collie
9%

Current Energy

Vitality +29 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail Rottweiler
Legs Husky
Front Legs Grey Wolf
Head Husky
Ears Dachshund
Snout Husky
Mouth Beagle
Nose Dachshund
Eyes Border Collie
Color Husky