Jade Jada Bitcoin Game Dog - Mix of Pug, Shiba Inu, Maltese, Border Collie and Yorkshire Terrier

Achievements

None
Jade Jada
I'm all about a hard drive because you can't do anything with a floppy disc. My favorite position is doggie style ;) I hate never catching that damn rabbit in my dreams. I like exploring off leash best. Dragging my butt on the carpet feels so good.
  • Purity 40%
  • Age 56 days
  • Racing Exp 0
  • Pug 64%
  • 0 races
  • Gen 15
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGTAACCTACGAAGAATTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
C
C
T
A
C
G
A
A
G
A
A
T
T
A
G
A
A
G
A
A
Genes: 222EKJ22F22

Composition

Pug
64%
Shiba Inu
9%
Maltese
9%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -28 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Maltese
Ears Border Collie
Snout Pug
Mouth Pug
Nose Yorkshire Terrier
Eyes Pug
Color Pug

Parents

No Children