Raison Romeo Crypto Dog - Mix of Grey Wolf, Golder Retriever, St. Bernard, Dachshund, Yorkshire Terrier, Pitbull terrier, Beagle, Schnauzer, Pug and Corgi

Achievements

None
Raison Romeo
How you doin? ;) Raison Romeo here. I'm sick of having my nails clipped, those are to help me dig! I'm the best at running circle 8's. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. If you are looking for companionship without commitment, so am I.
  • Purity 1%
  • Age 58 days
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGACCCTGAGGATTACCCTCCCTAATAGAAAGC
A
G
A
C
C
C
T
G
A
G
G
A
T
T
A
C
C
C
T
C
C
C
T
A
A
T
A
G
A
A
A
G
C
Genes: 8LBAFLNDC2O

Composition

Grey Wolf
18%
Golder Retriever
9%
St. Bernard
9%
Dachshund
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Beagle
9%
Schnauzer
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -7 points
Lunar Effect -6 points

Traits Breakdown

Body Golder Retriever
Tail Grey Wolf
Legs St. Bernard
Front Legs Dachshund
Head Yorkshire Terrier
Ears Grey Wolf
Snout Pitbull terrier
Mouth Beagle
Nose Schnauzer
Eyes Pug
Color Corgi

Parents

No Children