Otis Opie Bitcoin Dog - Mix of Pug, Yorkshire Terrier, Grey Wolf, Maltese, Husky, Corgi, Labrador BK, Pitbull terrier and Beagle

Achievements

None
Otis Opie
Size matters. This dawg's into big databases. It turns me on when I can show an older dog a new trick. Chasing anything that will run is so much fun, I could do that all day. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect!
  • Purity 8%
  • Age 58 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAATTACCCACCACAAGCGCATCCCTAGAA
G
A
A
G
A
A
T
T
A
C
C
C
A
C
C
A
C
A
A
G
C
G
C
A
T
C
C
C
T
A
G
A
A
Genes: 22FLK4O6ND2

Composition

Pug
27%
Yorkshire Terrier
9%
Grey Wolf
9%
Maltese
9%
Husky
9%
Corgi
9%
Labrador BK
9%
Pitbull terrier
9%
Beagle
9%

Current Energy

Vitality -4 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Yorkshire Terrier
Front Legs Grey Wolf
Head Maltese
Ears Husky
Snout Corgi
Mouth Labrador BK
Nose Pitbull terrier
Eyes Beagle
Color Pug