Mowgli Monkey Digital Cryptocurrency Dog - Mix of Border Collie, Husky, French Bulldog, Labrador, Pitbull terrier, Pug, Dachshund, Shiba Inu and Corgi

Achievements

None
Mowgli Monkey
My name is Mowgli Monkey and I do tricks. This dawg chases mice in a big data warehouse. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! As a designer, I suggest low windows or couch backs next to windows without curtains. I 'm here for something RUFF ;)
  • Purity 6%
  • Age 56 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACGACCATACTACTCCGAATACGGAGTAAGC
A
C
A
C
G
A
C
C
A
T
A
C
T
A
C
T
C
C
G
A
A
T
A
C
G
G
A
G
T
A
A
G
C
Genes: 495JJN2JAEO

Composition

Border Collie
27%
Husky
9%
French Bulldog
9%
Labrador
9%
Pitbull terrier
9%
Pug
9%
Dachshund
9%
Shiba Inu
9%
Corgi
9%

Current Energy

Vitality +41 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Labrador
Front Legs Border Collie
Head Border Collie
Ears Pitbull terrier
Snout Pug
Mouth Border Collie
Nose Dachshund
Eyes Shiba Inu
Color Corgi

Parents

No Children