Niki Nitro Cryptocurrency Game Dog - Mix of Maltese, Dachshund, Border Collie, Boxer, Beagle, Schnauzer and Shiba Inu

Achievements

None
Niki Nitro
How's it going? I'm Niki Nitro. I am not above stealing food off humans' plates. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 9%
  • Age 59 days
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCACCAACGGACTAATAGGATACACCTACGTA
A
C
C
A
C
C
A
A
C
G
G
A
C
T
A
A
T
A
G
G
A
T
A
C
A
C
C
T
A
C
G
T
A
Genes: KKGADCAJKJE

Composition

Maltese
27%
Dachshund
18%
Border Collie
18%
Boxer
9%
Beagle
9%
Schnauzer
9%
Shiba Inu
9%

Current Energy

Vitality -12 points
Lunar Effect +6 points

Traits Breakdown

Body Maltese
Tail Maltese
Legs Boxer
Front Legs Dachshund
Head Beagle
Ears Schnauzer
Snout Dachshund
Mouth Border Collie
Nose Maltese
Eyes Border Collie
Color Shiba Inu