Shot Side Zone Litecoin Game Dog - Mix of Yorkshire Terrier, Husky, Border Collie, Dachshund, Labrador BK, French Bulldog, German Shepard and Corgi

Achievements

None
Shot Side Zone
I enjoy destroying a nice fresh pair of slippers. You know the worst? Watching my humans 'get it on' and I have to lick myself. My favorite chews are underwear and rawhide...the rawhide lasts longer. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 9%
  • Age 56 days
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACATTATACGGAGCACGATCAAGCTTATTA
A
C
A
A
C
A
T
T
A
T
A
C
G
G
A
G
C
A
C
G
A
T
C
A
A
G
C
T
T
A
T
T
A
Genes: 44FJA697OFF

Composition

Yorkshire Terrier
27%
Husky
18%
Border Collie
9%
Dachshund
9%
Labrador BK
9%
French Bulldog
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality +6 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Husky
Legs Yorkshire Terrier
Front Legs Border Collie
Head Dachshund
Ears Labrador BK
Snout French Bulldog
Mouth German Shepard
Nose Corgi
Eyes Yorkshire Terrier
Color Yorkshire Terrier