Diva Dakota Crypto Dog - Mix of Golder Retriever, Beagle, Corgi, Border Collie, French Bulldog, Pug, Boxer, Pitbull terrier and Schnauzer

Achievements

None
Diva Dakota
I hate not being allowed to hunt treasure in the garbage. It smells so good! I like big butts, I cannot lie. I'm into group dog piles, the more the better. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 3%
  • Age 59 days
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCAGATACCTACGAGAAAACCTATCCAGAATA
A
G
C
A
G
A
T
A
C
C
T
A
C
G
A
G
A
A
A
A
C
C
T
A
T
C
C
A
G
A
A
T
A
Genes: O8JD92GDN8C

Composition

Golder Retriever
18%
Beagle
18%
Corgi
9%
Border Collie
9%
French Bulldog
9%
Pug
9%
Boxer
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality +1 points
Lunar Effect +6 points

Traits Breakdown

Body Corgi
Tail Golder Retriever
Legs Border Collie
Front Legs Beagle
Head French Bulldog
Ears Pug
Snout Boxer
Mouth Beagle
Nose Pitbull terrier
Eyes Golder Retriever
Color Schnauzer

Parents

No Children