Dab Dinky Digital Cryptocurrency Dog - Mix of Golder Retriever, Corgi, Shiba Inu, Maltese, Beagle, Schnauzer and Pug

Achievements

None
Dab Dinky
I'm Dab Dinky. How goes it? I've always had a crush on Lassie. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! You know the worst? Watching my humans 'get it on' and I have to lick myself.
  • Purity 12%
  • Age 59 days
  • Racing Exp 0
  • Golder Retriever 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAAGAACCAGAAGACTAAGCATAAGCAGCGAA
G
T
A
A
G
A
A
C
C
A
G
A
A
G
A
C
T
A
A
G
C
A
T
A
A
G
C
A
G
C
G
A
A
Genes: E8K88DOCOO2

Composition

Golder Retriever
27%
Corgi
27%
Shiba Inu
9%
Maltese
9%
Beagle
9%
Schnauzer
9%
Pug
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Maltese
Front Legs Golder Retriever
Head Golder Retriever
Ears Beagle
Snout Corgi
Mouth Schnauzer
Nose Corgi
Eyes Corgi
Color Pug