Dodger Denali Bitcoin Dog - Mix of German Shepard, Husky, Maltese, Shiba Inu, French Bulldog, Corgi, Dachshund and Boxer

Achievements

None
Dodger Denali
Barkjour mi amor! I'm Dodger Denali. I like to respond to sad puppy eyes with sad puppy eyes of my own. I hate it when other dogs pee in my yard! IT'S MY YARD!! My human's feet are definitely the greatest smell ever. Especially after a long day at work! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 4%
  • Age 59 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACGATCAAGCACAACCGGATCAACCACAAAC
G
T
A
C
G
A
T
C
A
A
G
C
A
C
A
A
C
C
G
G
A
T
C
A
A
C
C
A
C
A
A
A
C
Genes: E97O4KA7K4G

Composition

German Shepard
18%
Husky
18%
Maltese
18%
Shiba Inu
9%
French Bulldog
9%
Corgi
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality +12 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail French Bulldog
Legs German Shepard
Front Legs Corgi
Head Husky
Ears Maltese
Snout Dachshund
Mouth German Shepard
Nose Maltese
Eyes Husky
Color Boxer

Parents

No Children